                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:163 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.50 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-15.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggccatcgccgggcgcgctcatggccgccgcgtggtgaaaataaaaggcggcgcccgatccatgccgccaattggtgtgatcttgccaccgttcgcccaa
gaaaaaaggcacctcggcttgcgcctaagtgcctgttttccaacgaattcgagTGGGGTGGCTGATGGGACTCGAACCCA
CGACAACCGGAATCACAATCCGGGACTCTACCAACTGAGCTACAGCCACcgcagcaaagaaacg
agattctagcacaaaataaatgacgcatcagccccggcgcttccggcgggcaaatcTTG

    BPP2250 Gene: BPP2250     GI: 33596856     BI number: BPP2250     GOG: COG1502     Description: putative phospholipas   a        cc c  a      c  a c  t      g  a gt        cg cg        ta cg        ta gt       g  a tg       c  a at       c  a c  |      a  a cg        cg ta        cg        tg at        gc       t  c gc        ta        cg c  t      t  c       gc c  |      c  c       gc c  |      t  |      c  t gt        at       t  a cg        gc       c  a gc        tg        cg gc       g  |       at c  a       tg        cg gc        gc        gc gc        gt        gc                         tgttttccaacgaattcgagTGGGGTGGCTGATGGGACTCGAACCCACGACAACCGGAATCACAATCCGGGACTCTACCAACTGAGCTACAGCCACcgcagcaaagaaacgagattctagcacaaaataaatgacgcatcagccccggcgcttccggcgggcaaatcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1502 Phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthases and related enzymes ... can be seen here     ..................................................................................................................