                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-22.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCAGCGGTCCGGCCTCGGCTTTGAGGCGCAGGTATTGCTGCATCATAGGAGTATGGCC
GGCCAGGGCGTCGCCGGTCGTTTGCTTTGGTGTGGAAGACATAGGCAGGATTGTATCG
GGCCGCCCGCGCTGTCCGCCATGCGGCAGGCGCCGGGCCACCATGGTGTCGCGCGATG
ACGCATTGCGCAACATccggtgctgtgcgccgtttcttccctgtgctcaaatgaatcagccggcggcgcagtgcgcgcacgaggcgcg
tccggtcggcggccagcaaccgtacaaggagcaacgccATG

    BPP2266 Gene: BPP2266     GI: 33596869     BI number: BPP2266     GOG: COG3360     Description: conserved hypothetical protei   C A  G GC TA AT GT CG GC CG GC C  A TA GC TA GT Gc T  c A  |        g Cg       t  t Cg        cg At        gc C  |       tg Cg        gc Gc        gc Gt        cg             tttcttccctgtgctcaaatgaatcagccggcggcgcagtgcgcgcacgaggcgcgtccggtcggcggccagcaaccgtacaaggagcaacgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3360 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................