                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:15 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-16.40 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-30.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cgctgttcgccgaggagtacgccgacgtcatggagcgctacaagaacgcgctgttcgcggcgctgccgggcgtgccgcgcgccgaaatcatgtggcgctt
ccagttcatgctgggcaccacgtcgtacgccatcatgggcaccgacaccctgcgtttcgtgaccagctggacattcgaccaggccgaaccgcccgacaac
ccgcattggctgctgccccgcctgctcagcttcctgctgggcgggctgcgggcgcccctgcccgaactgccttaggcccatttcttgcggaggctggagc
ATG

    BPP2345 --- BPP2344 --- BPP2343 Gene: BPP2345     GI: 33596943     BI number: BPP2345     GOG: COG1960     Description: Putative acyl-CoA dehydrogenase Gene: BPP2344     GI: 33596942     BI number: BPP2344     GOG: COG0183     Description: Putative thiolase Gene: BPP2343     GI: 33596941     BI number: BPP2343     GOG: COG1024,COG1250     Description: Putative enoyl-CoA hydratase   c t  c       cc t  t      c  c cg        gt gc        cg at        gc cg        gc tg        gc cg        cg gc       |  a tg       |  a cg       |  c cg       |  t gc       |  g |  t      |  c |  g      |  c c  c      |  t cg       |  t cg       g  a cg        tg gc        cg t  |       gc cg        gc gc        gc             atttcttgcggaggctggagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1960 Acyl-CoA dehydrogenases ... can be seen here [I] COG0183 Acetyl-CoA acetyltransferase ... can be seen here [I] COG1024 Enoyl-CoA hydratase/carnithine racemase ... can be seen here [I] COG1250 3-hydroxyacyl-CoA dehydrogenase ... can be seen here     ..................................................................................................................