                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:45 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-11.19 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-42.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATCAACACCGGCATCATCTCCAATGAAGTCGGCCCGTTCGGCGGCGTCAAGCAATCC
GGCCTGGGCCGCGAAGGCTCGAAGTACGGGATCGAGGACTACCTCGAGCTGAAATACC
TCTGCGTGGACCTGGGCGCCTGAgtccagcccgcgggcaagcaaggccggcgccttcgggcgccggccttttttcgccttgcc
gcgcccgccctcatccaaacgccgcacacccaggcgccaagccccggccatttttgtcataggccggcgcgccggcccatgctagatttgcgggtcgtac
aTTG

    BPP2355 Gene: BPP2355     GI: 33596950     BI number: BPP2355     GOG: COG0483     Description: putative inositol monophosphatas tc t  g cg cg gc cg gc        tc gc       c  a cg       c  t cg       c  c gc       g  c gc       c  a at       c  a at       c  a        c |  t       gc       c  a |  t       cg       g  a |  t       gc        cg |  t      c  c       gc |  c       cg        gc cg        gc       a  c gc        ta       c  | |  c      |  c      c  | at       |  a      c  | at       |  c      a  | cg       |  c      c  | gc       |  c      a  | gc        ta       c  | |  g       cg        gc gc        cg        cg cg        gc        cg gc        cg        gc                         catttttgtcataggccggcgcgccggcccatgctagatttgcgggtcgtacaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0483 Archaeal fructose-1,6-bisphosphatase and related enzymes of inositol monophosphatase family ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_parapertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:111 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-29.00 kcal/mol Antiterminator: Size=42 nt.     Delta G=-18.40 kcal/mol Anti-antiterminator:   Size=31 nt.     Delta G=-15.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CATCAACACCGGCATCATCTCCAATGAAGTCGGCCCGTTCGGCGGCGTCAAGCAATCC GGCCTGGGCCGCGAAGGCTCGAAGTACGGGATCGAGGACTACCTCGAGCTGAAATACC TCTGCGTGGACCTGGGCGCCTGAgtccagcccgcgggcaagcaaggccggcgccttcgggcgccggccttttttcgccttgcc gcgcccgccctcatccaaacgccgcacacccaggcgccaagccccggccatttttgtcataggccggcgcgccggcccatgctagatttgcgggtcgtac aTTG     BPP2355 Gene: BPP2355     GI: 33596950     BI number: BPP2355     GOG: COG0483     Description: putative inositol monophosphatas            gc           c  g            cg            cg            gc           |  a           |  a           |  g CT       |  c C  G      a  a G  A      c  a Cg        cg        tc Gt        tg       t  g Gc        gc        cg Gc       A  c       cg Ta       G  |       gc Cg       T  |       cg C  c       Cg        gc A  |       Cg        gc Gc        Gc        cg Gc        Cg        cg Tg        Gc        gc Gc        Gc        gc Cg        Gt        at                         tttttcgccttgccgcgcccgccctcatccaaacgccgcacacccaggcgccaagccccggccatttttgtcataggccggcgcgccggcccatgctagatttgcgggtcgtacaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0483 Archaeal fructose-1,6-bisphosphatase and related enzymes of inositol monophosphatase family ... can be seen here     ..................................................................................................................