                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:169 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-12.10 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-24.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACACGATTCGGTGCCGAAGGCCACGGCGGCCAGGTACGAGGCCTTGACCTTGGCGGCG
TCGTCCACGCCGGCGGGCACGCGGTAGGTCAGCAGCTCCAGCAGATTCTGCGCCTCGC
CATCCGGCGGGTTTTTCAGCAGCTCGATCAGGTCAGCGGTTTGTTGCGCGGACAGCGG
CAGCGGCGGAATGCCCAGGGCTGCACGGTCGGCGACGTGTTGACGGTACGTTTCCAGC
ATggatggcctgcgtaatagtcgggttggaacaagggttgtagccgggattgtagagggataggggcaATG

    BPP2401 --- BPP2402 Gene: BPP2401     GI: 33596994     BI number: BPP2401     GOG: COG0847     Description: putative exonuclease Gene: BPP2402     GI: 33596995     BI number: BPP2402     GOG: COG1694     Description: conserved hypothetical protei CC G  G C  G A  C CG CG TG         T GC       C  C C  |      G  C TA       A  A GC        CG CG        GC GC       A  A G  G       CG CG        TA GT        GT G  |      G  T T  |      A  | TA       T  | CG        GC CG        GT AT        CG GC        GC        TC TA        CG       A  C TG       A  C       CG |  C      C  |       CG C  A       GC        GC CG        GT        CG GC        GC        TG GT        CG        CG                         TTTTTCAGCAGCTCGATCAGGTCAGCGGTTTGTTGCGCGGACAGCGGCAGCGGCGGAATGCCCAGGGCTGCACGGTCGGCGACGTGTTGACGGTACGTTTCCAGCATggatggcctgcgtaatagtcgggttggaacaagggttgtagccgggattgtagagggataggggcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0847 DNA polymerase III, epsilon subunit and related 3'-5' exonucleases ... can be seen here [R] COG1694 Predicted pyrophosphatase ... can be seen here     ..................................................................................................................