                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G=-13.10 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-15.10 kcal/mol
Anti-antiterminator:   Size=19 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACCAGCCGGGCCGCTTCCTGGGGGGAAGCCAACCGGGCGCGCAGGCCGGGATGGCGA
ATACGTTCGAGATGCATgctgtctccagacatcaatggtggccacggcgcgcagtccgggtgggattgcgtcgcgcctcctgtgcccg
ggcgccgtctgccgcggcgttttccgtcaaaacgtccaccggatggccggtgcgaccaaatttttccgcagtataggcagcccgcggcaaatctcgtaat
gacttaaaatcatccaatcgattcgtttttttcatcgtttgcgagtttccgcccATG

    BPP2410 Gene: BPP2410     GI: 33597003     BI number: BPP2410     GOG: COG0583     Description: putative LysR-family transcriptional activato             g           c  t           c  c            ta            ta            ta            ta            gc            cg            gt            gc        tg           c  c      a  g   g       g  a       gc t  c      c  c       gc c  c      c  |       cg tg        gc        cg gc        tg        at cg        cg        cg cg        ta       |  c gc        gt        cg cg        cg        ta gt        cg        gc                         caaatttttccgcagtataggcagcccgcggcaaatctcgtaatgacttaaaatcatccaatcgattcgtttttttcatcgtttgcgagtttccgcccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0583 Transcriptional regulator ... can be seen here     ..................................................................................................................