                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-14.40 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -9.54 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-17.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGACGTCGCCGAAGGCCTGCGCAAGGCCGGCTTCGAAGCCGTCGAGAAGTCGCAGGTG
CGCATGCCCAATGGCCAGATCAAGGCCGTGGGCGAGTACCCTGTGCAAGCGGTGCTGC
ACGCCGACGTCGTTGCCGACGTGGTGGTGCTGGTCGAAGGCGAAATGGCCTGAttgtccgg
catgcctgaaaaaaaccggtcgcgcgaccggtttttttttggttcatcgcgcaatagcgtggaggggtttggcaagttttcgtattcttgacggcaggta
tttgccatcaggagtgcagggagATG

    BPP2470 --- BPP2471 --- dnaB Gene: BPP2470     GI: 33597058     BI number: BPP2470     GOG: COG3464     Description: transposase Gene: BPP2471     GI: 33597059     BI number: BPP2471     GOG: NOG09259     Description: hypothetical protein Gene: dnaB     GI: 33597060     BI number: BPP2472     GOG: COG0305     Description: DNA helicas            at           c  g            gc            gc           c  t            cg AA        ta A  T      |  a G  G      |  a CG       g  a GC       t  a GC       t  a AT       A  a |  G      G  c |  A      T  c       cg At        Cg       g  c Gt        Cg        cg Cg        Gt        ta T  t       Gc        gc Gc       T  g       gc Gc       A  |       cg Tg       A  |       cg Cg       A  |       at Gc        Gc        at Ta        Cg        at Gt        Gc        at                         tttttggttcatcgcgcaatagcgtggaggggtttggcaagttttcgtattcttgacggcaggtatttgccatcaggagtgcagggagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG3464 Transposase and inactivated derivatives ... can be seen here [L] COG0305 Replicative DNA helicase ... can be seen here     ..................................................................................................................