Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-17.40 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-17.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACCCGTGCCGGCCCCGGCACCAAGGTAGTCTGCCTGGGCAACGTGGCGCAGATCGAC
ACGCCCTACCTGACCGAAGGCAGTTCCGGCCTGACCTTCGTGGTGGACCGCTTCAAGG
GTTGGCCGCATTCCGGCCACGTCACCTTGCAGCGCGGCGAACGCTCCCGCCTGGCCGA
CTACGCCGGCGACGTGCTCTAGcatccacccatgccggaagaaggccctgcggggccttctttttttgcccggcgtgcccggcg
gtgtagcatggtcgcattcccgacttccgcaccactgcaaccATG

    BPP2474


Gene: BPP2474     GI: 33597062     BI number: BPP2474     GOG: COG1995     Description: conserved hypothetical protei


  C
A  T
G  A
C  C
 CG
 GC
 GC
T  |
 CG
 CG        ac
 GC       c  c
 CG       c  c
C  A       ta
C  |       at
T  |       cg
C  |       Gc
G  |      A  c
C  |      T  g
A  |       Cg
A  |       Ta
G  |      C  a
C  |      G  g
G  |      T  a
 GC       G  a       gc
 CG       C  g      t  g
 GT       A  |       cg
 CG       G  |       cg
 GC        Cg        cg
 AT        Gc        gc
|  C       Gc        gc
|  T      |  c       at
|  A      C  t       at
 CG        Cg        gc
 Gc        Gc        at
 Ta        Cg        at
                        tttttgcccggcgtgcccggcggtgtagcatggtcgcattcccgacttccgcaccactgcaaccATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[H] COG1995 Pyridoxal phosphate biosynthesis protein ... can be seen here

    ..................................................................................................................