Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:1 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGGAAGGGAACGATCAGGCGGATCGGCTTGTTGGGATAGGCGTCTTGGGCGTGCGCG
ACGCCGGCGGCCAGCGGGGCGGCCAGGATCGCGGCGAGGGACAGGCCCAGGATGACAT
TACGACGTTGCATggtttcccctgtaggaagatgtttagatcagtgcgcgaactttgtggttcttggcgcagactgcgtcattctgtaagg
ggtatctggtttgcgcaaacgaaagattctccgtaagctattccttttactcatggctggtttgtcataaaacctgaatcggccccttttttcATG

    BPP2502 --- trmU


Gene: BPP2502     GI: 33597090     BI number: BPP2502     GOG: COG0583     Description: putative LysR-family transcriptional regulator
Gene: trmU     GI: 33597091     BI number: BPP2503     GOG: COG0482     Description: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferas


 cg
g  c        t
 ta       t  t
 ta       t  a
 ta       c  c
 gc       c  t
|  g      t  c
|  a       ta
g  a       at
 ta        tg        aa
 cg        cg       t  a
 ta        gc       a  a
 at        at       c  c
t  t      a  |      t  c
 gc       t  |      g  t
 gt       g  |       tg
 gc        cg        ta
 gc        cg        ta
a  g      t  t       gt
a  t      c  t       gc
t  a      t  t       tg
g  |       tg        cg
 ta        at        gc
 cg        gc        gc
                        ccttttttcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG0583 Transcriptional regulator ... can be seen here
[J] COG0482 Predicted tRNA(5-methylaminomethyl-2-thiouridylate) methyltransferase, contains the PP-loop ATPase domain ... can be seen here

    ..................................................................................................................