                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-14.40 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-12.10 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-19.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACCGGCAACGCGCCGGCTGCCCAGCTGCCGCCCGCCACGCCAGCCTCGCAGGACGGC
CCGGCCATCTGGCTGCGCGCCGCCGTGGTGGGCGCCTGTTGCGCGGCGCTCGTGCTGT
GGATACAGGCGCAGGCCGTCGCCGTCGACATGTCGTTCTCCTAGcgcgggcaagcgccggaacgaac
gaaaaaaaaccggtcgcgcgaccggtttttttttggttcatcgcgcaatagcgtggaggggtttggcaagttttcgtattcttgacggcaggtatttgcc
atcaggagtgcagggagATG

    BPP2508 Gene: BPP2508     GI: 33597096     BI number: BPP2508     GOG: -------     Description: transposas AT C  G AT GC        ga CG       c  a |  T      a  a |  T      a  a |  C      g  a |  T      c  a |  C      a  a T  C      a  a G  T       gc C  A       gc CG        cg Gc        cg Cg        gt T  c      c  |       cg G  g      g  |      g  c Cg       a  |       cg Cg       a  |       ta Gc       c  |       gc G  a      g  |       gc A  a      g  |       cg Cg        gc        cg Gc        cg        at Cg        gc        at Gc        cg        at Gc        Gc        at                         tttttggttcatcgcgcaatagcgtggaggggtttggcaagttttcgtattcttgacggcaggtatttgccatcaggagtgcagggagATG     ..................................................................................................................