Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=3 nt.   Size=25 nt.     Delta G=-21.70 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -9.60 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-23.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGCCACGGGTACCGTTAAATGGTTCAACGATGCGAAGGGGTTCGGATTCATCACGCC
CGATGACGGCGGTGAAGATCTGTTCGCGCATTTCTCGTCCATCCAGATGAACGGTTTC
AAAACCCTAAAAGAAGGCCAGAAGGTCTCGTTCGAGATCATTCAGGGTCCCAAGGGCA
AACAGGCACTCAATATTACGTCTGCCTGAgcaccattgcttatcgcgtcgccactgcgccgataccatttggcgccggg
cgtcgttattatttgaggcggggctgcatgccccgccttttattattTTG

    BPP2570


Gene: BPP2570     GI: 33597155     BI number: BPP2570     GOG: COG1430     Description: exported protei


 cc
a  a
t  t
 at
 gt
 cg
 cg        tt
 gc       a  a
 cg       t  t        c
 gc       t  t      g  a
t  c       gt       t  t
c  g       cg        cg
a  |       ta        gc
 cg       g  g       gc
 cg        cg        gc
 gc        gc        gc
 cg       g  g       cg
t  t      g  g       gc
 gc        cg        gc
 cg        cg        at
 gt        gc        gt
                        ttattattTTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG1430 Uncharacterized conserved protein ... can be seen here

    ..................................................................................................................