                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:150 nt.    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-17.60 kcal/mol
Antiterminator:    Distance from promoter:117 nt. Size=47 nt.     Delta G=-14.40 kcal/mol
Anti-antiterminator:    Distance from promoter:109 nt.    Size=20 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttggcg-aagaat. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttggcgttgccgtgcccctcgggaagaatggcctgcatgggtggcggcgttgccgctatccatgcaggcctggaacggtgtcgcggcaatcgaccccctt
ccgttgggccacggggcgtagctgacggctgcttctcgggatcgccggctggcgatttagtttttctcctgtgctttgaaaggcggcgccgcttgcgggc
cgcttttttttcgcttggcgtcggcgctgcgcgaggctctacactGTG

    BPP2594 Gene: BPP2594     GI: 33597175     BI number: BPP2594     GOG: COG2960     Description: conserved hypothetical protei             t           g  g           t  c           c  t           c  t           t  t            cg            ta            ta            ta            tg            tg            gc        tt           a  g      c  g           t  g       gc           t  |       cg gc       t  |       cg g  t      a  |      g  | cg        gc        cg cg        cg        gc gc        gc        gc cg        gc        cg ta       t  |       gc at        cg        gt gt        gc        at gt        gt        at                         tttttcgcttggcgtcggcgctgcgcgaggctctacactGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2960 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_parapertussis                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:109 nt.    Distance to gene:79 nt.     Distance to run of Ts=1 nt.   Size=20 nt.     Delta G= -9.40 kcal/mol Antiterminator:    Distance from promoter:71 nt. Size=48 nt.     Delta G=-21.30 kcal/mol Anti-antiterminator:    Distance from promoter:37 nt.    Size=44 nt.     Delta G=-18.30 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttggcg-aagaat. It has a score value of 64.26 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttggcgttgccgtgcccctcgggaagaatggcctgcatgggtggcggcgttgccgctatccatgcaggcctggaacggtgtcgcggcaatcgaccccctt ccgttgggccacggggcgtagctgacggctgcttctcgggatcgccggctggcgatttagtttttctcctgtgctttgaaaggcggcgccgcttgcgggc cgcttttttttcgcttggcgtcggcgctgcgcgaggctctacactGTG     BPP2594 Gene: BPP2594     GI: 33597175     BI number: BPP2594     GOG: COG2960     Description: conserved hypothetical protei             a   c       g  c g  a      t  g g  a       cg c  t       gc gc        at cg        tg ta        gc gc       c  t t  c       gt gc        gc gc        gt c  c       gc at        cg at       a  | gc        cg        gc gc        cg       g  t |  g      g  a       cg |  t      g  t       cg |  t       gc        gc tg        tg        cg cg       t  c       ta cg        gc        at gc        cg        gt gc        cg        gt                         agtttttctcctgtgctttgaaaggcggcgccgcttgcgggccgcttttttttcgcttggcgtcggcgctgcgcgaggctctacactGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2960 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................