                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:3 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-18.00 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-21.60 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-15.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgcagaaagcacgccgctgcgttatcctgagccggtccggctcggacccgccggctttcccgtcgctcgttcgacgcttcccagtccaggagatgtcAT
GAAGAACAAAGCTCTCATTGTTGTGCTGCTTGCCATGGCCGCGCTGTCCGCGGGTTGC
AATACGGTTGCCGGCGCGGGCAAGGATATCGAGCGAGGTGGCGAAAAAATCCAGGGTG
CGGCCCAGAAGTAGcgcaaggcggcgtagctagccgcgccatgcgcagccgcctgccgcgatagggcgccaaggcggctttttcaTTG

    BPP2615 --- BPP2616 --- pyrB Gene: BPP2615     GI: 33597196     BI number: BPP2615     GOG: -------     Description: putative lipoprotein Gene: BPP2616     GI: 33597197     BI number: BPP2616     GOG: -------     Description: putative integral membrane protein Gene: pyrB     GI: 33597198     BI number: BPP2617     GOG: COG0540     Description: aspartate transcarbamoylas             g           c  c gg        cg a  c       gc a  g      |  c cg       a  a gc       t  t cg        cg Gt        gc        ta A  a      a  g      a  g Tg       t  c      g  g Gc       g  a       cg At        cg        gc A  a       gc        cg G  |       gc       |  c A  |       cg       c  c C  |       gc       g  a C  |       gc        ta Cg        at        cg Gc       a  g       cg Gc       c  c       gc Cg        gc        cg Gc        cg        cg Tg        Gc        gc                         tttttcaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0540 Aspartate carbamoyltransferase, catalytic chain ... can be seen here     ..................................................................................................................