Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-18.30 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-15.50 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-21.43 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCCTGAacagagcgtaacggcggagatctcatATGCGCAGCAAGATAGTGCTGACGGCTTTCGTGGTG
TTTGGATTCGTCCTGCAGGGCTGCAACACCGTTGCAGGAATGGGCAAGGATATGTCCG
ATGCGGGCAGTGCCATTACCCACGCTGCCGAGAAGTAGccggcccgcgccggcatgatgcaagcccccggtt
gctccgggggttttttttggttcatcgcgcaatagcgtggaggggtttggcaagttttcgtattcttgacggcaggtatttgccatcaggagtgcaggga
gATG

    BPP2649


Gene: BPP2649     GI: 33597229     BI number: BPP2649     GOG: -------     Description: transposas


 AG
G  A
C  A
 CG
 GT
 TA
 CG
 Gc
C  c
A  g
C  |
C  |
C  |        g
A  |      t  a
T  |      a  t
T  |       cg
A  |       gc
C  |      g  a
C  |      c  a
G  |      c  |
T  |      g  |
G  |       cg         g
A  |       gc       t  c
 Cg       c  c      t  t
 Gc       c  c       gc
 Gc       c  |       gc
 Gc        gc        cg
 Cg        gc        cg
 Gc        cg        cg
 Tg        cg        cg
A  c       Gt        cg
 Gc        At        gt
 Cg        Tg        at
 Cg        Gc        at
                        tttttggttcatcgcgcaatagcgtggaggggtttggcaagttttcgtattcttgacggcaggtatttgccatcaggagtgcagggagATG


    ..................................................................................................................