                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-20.20 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-18.90 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-20.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCCACGCCGCGACGAGGCGCCCGCGGCAAGAAAGCCGCGGCCGGGCGAAGAGCAGG
CCGACGGCAGCCCGGGCGAAGCGGGCGCCATCTCCAACCCCATGCCCGGGCTGAGCCC
GCAACGCACGCCGGGCATAGACCGCTGGTCGGAGAACGACTTCGAGGCGGTCTGGCGG
CGCGCTACGCGGGAGCTGTGAcagagaccgcaacggccgtgccgcggggcggcacgcgacttgcgcactgcggccggcgagcgtt
cgccacctcggcggcgccggcattttctgcaaggagacgtcATG

    BPP2654 Gene: BPP2654     GI: 33597233     BI number: BPP2654     GOG: COG4575     Description: conserved hypothetical protei   g g  g       tg cg       c  c gc       a  g cg        cg cg        gc gc       |  c        c ta       |  g      c  t gc        cg       a  c cg        gc        cg c  c       tg        cg g  g       ta        gc g  a       cg        cg c  c      a  |       tg at        gc       t  | at        cg       g  | cg        gt       c  | gc       c  t      g  | cg       a  c      a  | c  c       cg        gc a  a       gc        cg g  |       gc        gc a  |      c  a       gc gc        gc        cg at        gc        cg cg        gt        gc                         attttctgcaaggagacgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4575 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................