                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:202 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G=-16.30 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-12.00 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACGGCGCCGATATGGCCCGCTGCATCGCGCTGGACCTGGACTGCGCCGCCGCCTGTC
GCCTGTGTGCCGCCATGATGGCGCGCGAAAGCGAATTTTCTACACATATGTGCACCTT
GTGCGCGCGCATCTGCGAAGTGTGCGGCGACGAGTGCGCCCGCCACGAGCCGCGCCAC
TGCCAGGAATGCGCCACGGCCTGCCATGCCTGCGCCAGCGCCTGCCGCGCCATGGCCC
GGCCCTGAggccacgccccaccggcttcgtcccgccccaaccccttcccccaaccggagcagcccgccATG

    BPP2666 --- BPP2665 Gene: BPP2666     GI: 33597243     BI number: BPP2666     GOG: COG4575     Description: Conserved hypothetical protein Gene: BPP2665     GI: 33597242     BI number: BPP2665     GOG: COG1273     Description: putative membrane protei            CG           C  C            GC            CG            GC        AT           |  C      C  G           T  T      C  A            CG        GT            AT        CG            GC        CG CT       G  G       GC C  G      T  |       TG A  G      C  |       GC G  A      C  |       TG G  C      A  |       GC T  T       GC        TG CG        GC       |  A GC       T  T      |  A CG        CG       C  A |  C       GT        CG GC        CG        GC CG        GT        CG GC        CG        TA                         ATTTTCTACACATATGTGCACCTTGTGCGCGCGCATCTGCGAAGTGTGCGGCGACGAGTGCGCCCGCCACGAGCCGCGCCACTGCCAGGAATGCGCCACGGCCTGCCATGCCTGCGCCAGCGCCTGCCGCGCCATGGCCCGGCCCTGAggccacgccccaccggcttcgtcccgccccaaccccttcccccaaccggagcagcccgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4575 Uncharacterized conserved protein ... can be seen here [S] COG1273 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................