                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:204 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-20.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATAAACAGGGATGGTTGGAGGAATGCCATccagcgtaccaccagcccggcgtgcgtgcgcgctcatgggctgcggaa
atcacttccgtgttttatttaatatatttaatatcaacaagttaagtatattttttaatcttgattatttaaagtgacttctaaacaaatggtagcccgg
acgagccgggttgcggcgctttgcgccgcagcccatgggagcgcgcaaggagaattatgctgatgaacgcataattttcagattaactgctaaaatatgc
taccgatcgcataaattaagacGTG

    BPP2764 --- BPP2765 Gene: BPP2764     GI: 33597328     BI number: BPP2764     GOG: -------     Description: Putative transcriptional regulator Gene: BPP2765     GI: 33597329     BI number: BPP2765     GOG: COG3550     Description: Conserved hypothetical protei gt c  g gc tg gc cg gc gt |  c        c |  a      t  a |  t      a  c cg        at cg        at cg        gc gc        gc at        cg cg        gt c  c      t  | a  |       cg cg        gt cg        gt             ttatttaatatatttaatatcaacaagttaagtatattttttaatcttgattatttaaagtgacttctaaacaaatggtagcccggacgagccgggttgcggcgctttgcgccgcagcccatgggagcgcgcaaggagaattatgctgatgaacgcataattttcagattaactgctaaaatatgctaccgatcgcataaattaagacGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3550 Uncharacterized protein related to capsule biosynthesis enzymes ... can be seen here     ..................................................................................................................