                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:147 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -9.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGACTGGACGACGCTCAAGGATGGGCCGCATTTCCAGCTGCCGCGCGGTTGGCGCGGG
AAAGCGTGAgcgcgttgttcaggttggtcgcgccgtatctgatcggcgctggcgcacgccgcggcctggaccgtgcccggtcaattgccatttg
ttccgtccgtggtatcggggtagccgccatgtggcggcggatttgcaaggactcttgtagcgggtcggtctggatactgctttcggcggagttaccgttt
gtgccgttcttgctagtctgctccttcgcacgaccaaggagggtggcaATG

    BPP2836 Gene: BPP2836     GI: 33597393     BI number: BPP2836     GOG: -------     Description: putative membrane protei   g        gc g  c      t  c c  c       gc gt        cg cg        cg cg        at g  a       gc c  c      |  a a  c      g  a cg       t  t gt       c  t cg        cg gc        gc gc        gc             atttgttccgtccgtggtatcggggtagccgccatgtggcggcggatttgcaaggactcttgtagcgggtcggtctggatactgctttcggcggagttaccgtttgtgccgttcttgctagtctgctccttcgcacgaccaaggagggtggcaATG     ..................................................................................................................