                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-20.80 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-10.35 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G=-10.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAAGCGCTGCGCAAGCTGCGCCACCCCAGCCGCGCCGACAAGCTGAAGAGCTTCCTC
GAAGGGCAGTAAacatttcctGGGCCTCTAGCTCATGCCTGGTTAGAGCAGCGGACTCATA
ATCCGTTGGTGCCGAGTTCGACTCTCGGGGGGCCTACCAaagaaatcctgagaaatcaggtacctacagcc
gccagcaatggcggctgttttctttttcgcgtccgtccggctcggtccctggacgccggaaaccggaagtggcttgcgatagtcccaaattgggactatg
aattcaattcATG

    BPP2839 --- BPP2838 Gene: BPP2839     GI: 33597396     BI number: BPP2839     GOG: COG4680     Description: putative membrane protein Gene: BPP2838     GI: 33597395     BI number: BPP2838     GOG: COG5499     Description: conserved hypothetical protei            aa           g  a            at            gc            ta            cg            cg   C       t  t C  A      a  a A  a      a  c Ta       a  c Cg       g  t       ca C  a      a  a      g  a G  a      a  c       at G  a      A  a       cg Gt       C  g       cg Gc       C  c       gc Gc       A  c       cg Gt       T  |       cg Cg       C  |       gc Ta        Cg        at Cg        Gc        cg Ta        Gc        at                         tttctttttcgcgtccgtccggctcggtccctggacgccggaaaccggaagtggcttgcgatagtcccaaattgggactatgaattcaattcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4680 Uncharacterized protein conserved in bacteria ... can be seen here [K] COG5499 Predicted transcription regulator containing HTH domain ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_parapertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-14.90 kcal/mol Antiterminator: Size=44 nt.     Delta G=-10.35 kcal/mol Anti-antiterminator:   Size=58 nt.     Delta G=-13.26 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CAAAGCGCTGCGCAAGCTGCGCCACCCCAGCCGCGCCGACAAGCTGAAGAGCTTCCTC GAAGGGCAGTAAacatttcctGGGCCTCTAGCTCATGCCTGGTTAGAGCAGCGGACTCATA ATCCGTTGGTGCCGAGTTCGACTCTCGGGGGGCCTACCAaagaaatcctgagaaatcaggtacctacagcc gccagcaatggcggctgttttctttttcgcgtccgtccggctcggtccctggacgccggaaaccggaagtggcttgcgatagtcccaaattgggactatg aattcaattcATG     BPP2839 --- BPP2838 Gene: BPP2839     GI: 33597396     BI number: BPP2839     GOG: COG4680     Description: putative membrane protein Gene: BPP2838     GI: 33597395     BI number: BPP2838     GOG: COG5499     Description: conserved hypothetical protei   G C  A T  C T  T GC AT GC CG CG |  G |  G       ga |  G      a  a |  G       ga |  C       tt |  C       cc GT        ca TA        tg GC       a  g GC       a  t TA       a  a Ta       g  c |  a      a  c G  g      a  t C  a      A  a C  a      C  c       ca T  a      C  a      g  a A  t      A  g       at A  c      T  c       cg T  c      C  |       cg At       C  |       gc Cg        Gc        cg Ta        Gg        cg Cg        Gc        gc                         tgttttctttttcgcgtccgtccggctcggtccctggacgccggaaaccggaagtggcttgcgatagtcccaaattgggactatgaattcaattcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4680 Uncharacterized protein conserved in bacteria ... can be seen here [K] COG5499 Predicted transcription regulator containing HTH domain ... can be seen here     ..................................................................................................................