Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:136 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-18.30 kcal/mol
Antiterminator: Size=13 nt.     Delta G= -4.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCTGGCGGTGCCCAACGGCTCGGGGGCGCACGGCTTGCCGACCTCCCTGCAGATCG
TCGGCCTGCCCGAATCGGACCGGCTGGTGATGTCGCTGGGGCGCGCCTACCAGGAATA
TGCGTAGggcgcgacgcgctgcgggccggccgctggccggccttttttatggccatgcagatcgcctggcaaggcatggtgcccgattgatccat
gcgtacatgtcggtctaggcgcgccccgccggctgcgtcaccatgcctggcatcccgcggccgtcgcgccgccttgccaggaaagtcgcATG

    BPP2878 --- BPP2877 --- BPP2876


Gene: BPP2878     GI: 33597433     BI number: BPP2878     GOG: -------     Description: putative lipoprotein
Gene: BPP2877     GI: 33597432     BI number: BPP2877     GOG: COG1450     Description: lipoprotein
Gene: BPP2876     GI: 33597431     BI number: BPP2876     GOG: -------     Description: hypothetical protei



            c
          g  t
           cg
           cg
  c        gc
c  g       gc
g  g       cg
 gc        cg
 gc        gc
 cg        gc
 gc        gt
            tttttatggccatgcagatcgcctggcaaggcatggtgcccgattgatccatgcgtacatgtcggtctaggcgcgccccgccggctgcgtcaccatgcctggcatcccgcggccgtcgcgccgccttgccaggaaagtcgcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[NU] COG1450 Type II secretory pathway, component PulD ... can be seen here

    ..................................................................................................................