Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-16.60 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -9.40 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-22.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCACCAGGATGCGCGCCTGTACGCGGGCCTGTTCGACGGCACGGAAAGCGCCGAGCTG
CCGTTGGCGGCCGGACGCCGCTCGTGGGTGCACGTGGCGCGCGGCAGCCTGGTCGTCA
ATGGCCAGAGGCTGGGCGCGGGCGATGGCCTGGCGCTGCAGGACGAGGCCGCGGTGCG
GCTGGGCGACGGCGAAGGCGCCGAAGTCCTGGTATTCGATTTGCCGTAAagtgagacgggcgcc
gccagccggcgcccatttttccacggcgcggccgcgcggccagccggtacaggaggagagccATG

    BPP2983


Gene: BPP2983     GI: 33597527     BI number: BPP2983     GOG: COG1741     Description: conserved hypothetical protei


 AG
A  G
 GC
 CG
 GC
 GC
 CG
A  A
G  A       gt
 CG       a  g
 GT       A  a
 GC       A  g
 GC        Ta
|  T       Gc
 TG        Cg
 CG        Cg
 GT       G  g
|  A      T  |
|  T      T  |
|  T      T  |
 GC       A  |        a
 CG        Gc       c  g
|  A       Cg       c  c
|  T      T  c       gc
|  T      T  c       cg
G  T      A  |       cg
 TG        Tg        gc
 GC        Gc        cg
 GC        Gc        gc
 CG        Ta        gc
 GT        Cg        gc
                        atttttccacggcgcggccgcgcggccagccggtacaggaggagagccATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG1741 Pirin-related protein ... can be seen here

    ..................................................................................................................