Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:56 nt.     Distance to run of Ts=2 nt.   Size=24 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=36 nt.     Delta G=-21.70 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-19.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCTGCCCCGCTCGAACAGCAGTTCGCCCAGGTCGTTCTCGAGCGCGGCAATGCGCCC
CGAGATGGCGGCCTGGGTCAGGTGCAGTTTGCCCGCGGCGGCCTTGAAGCTGCGCAGC
TGGGCGACCCAGATAAAGGTTTCGAGAAAGCGGATATTCATggcgttccccgtgcgcgagtcgcggcggc
cgggttgcgcgggtaatccccagtgcgccggccgggcgttgctgtgtgtttttttttgatgaaatatagataaattattagtatttcgtctacaagaact
ttcggccacccgtcATG

    BPP3013


Gene: BPP3013     GI: 33597556     BI number: BPP3013     GOG: COG5631     Description: conserved hypothetical protei


 tc
g  g
a  c
g  g
 cg
 gc
 cg
g  g        a
t  c      a  t
 gc       t  c
 cg        gc
 cg        gc
 cg        gc
c  t      |  a
t  t       cg         c
 tg        gt       g  c
 gc        cg       g  g
 cg        gc        cg
 gc        tg        cg
g  |      t  |       gc
T  |      g  |       cg
A  |       gc       |  t
 Cg        gc        gt
 Tg        cg        tg
 Tg        cg        gc
 At        gc        at
 Ta        gc        cg
                        tgtgtttttttttgatgaaatatagataaattattagtatttcgtctacaagaactttcggccacccgtcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG5631 Predicted transcription regulator, contains HTH domain (MarR family) ... can be seen here

    ..................................................................................................................