                                                                        Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:31 nt.     Distance to run of Ts=3 nt.   Size=27 nt.     Delta G=-24.80 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-23.74 kcal/mol
Anti-antiterminator:   Size=18 nt.     Delta G=-15.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gccgcgtgtgcccgtatccggtcaagggcaagatggtgctggtgcagcctaccgacgccgaccgggcgttgctgaagaaagtgaccgaagaggcggtgct
gcccaagtgggccgcccggtgctcggcgcagtgcgtcagcgacttcaacgccaccatcggcaagacgctgggtctggtcgccaagaagtaagtccggacg
cgggccggccggcccgccccaatgctgcaacgcgcgccgcggcccggtcgcggcgcgcctggtttttcgccaccgcgggcatgcccgcagaggttcattc
ATG

    BPP3037 Gene: BPP3037     GI: 33597575     BI number: BPP3037     GOG: COG4665     Description: hypothetical protei            gc           t  t           a  g           a  c           c  a           c  a           c  c            cg            gc            cg           c  c        c            cg       c  g            gc        cg            gc        gt            cg        gc gc       c  |       cg g  c      g  |       gc cg        gc        cg cg        cg        cg gc        cg        gc gc        gc        cg gc        gc        gc cg        gc        cg gc        cg        gc                         ctggtttttcgccaccgcgggcatgcccgcagaggttcattcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG4665 TRAP-type mannitol/chloroaromatic compound transport system, small permease component ... can be seen here     ..................................................................................................................