Gene putatively regulated by attenuation in B_parapertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:181 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G=-12.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -8.97 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-13.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tctcctgcgtgctggaaacaatcttaaggcatttgggtggctttggctgccctagaccgttgcattgaccgtggatattgagcatttcagggctcgccgc
cttgatcatgttggtttttggcaacaaggcggggaagcgcgcaagcaagcccgccggggcggccccaaaggaggcaaaaaggatcgaatgatagaatttc
ctgtttacccggctcgggttcatccttacatacgattctgtcgcctatatatatggattccttcgccaaggagacgcttccggtatcgctggaagaagag
ATG

    gyrA --- serC --- pheA --- tyrA --- aroA --- cmk


Gene: gyrA     GI: 33597666     BI number: BPP3134     GOG: COG0188     Description: DNA gyrase subunit A
Gene: serC     GI: 33597665     BI number: BPP3133     GOG: COG1932     Description: phosphoserine aminotransferase
Gene: pheA     GI: 33597664     BI number: BPP3132     GOG: COG0077,COG1605     Description: p-protein [includes: chorismate mutase and prephenate dehydratase]
Gene: tyrA     GI: 33597663     BI number: BPP3131     GOG: COG0287     Description: prephenate dehydrogenase
Gene: aroA     GI: 33597662     BI number: BPP3130     GOG: COG0128     Description: 3-phosphoshikimate 1-carboxyvinyltransferase
Gene: cmk     GI: 33597661     BI number: BPP3129     GOG: COG0283     Description: cytidylate kinas


 tt
t  g       tg
 cg       g  g
 gc       c  a
g  t      c  t
t  g      a  a
 gc       g  t
 gc       t  t
 gc       t  g        g
t  t      a  a      c  c
t  a       cg       t  c
t  g       gc        cg
a  a       ta        gc
c  |      t  t       gc
 gc       g  t       gt
 gc       c  |       at
a  g      c  |       cg
a  t       at        ta
t  t       gc       |  t
t  g      a  |      t  c
c  c       ta        ta
 ta        cg        at
 at        cg        cg
 at        cg        gt
 cg        gc        at
                        ggtttttggcaacaaggcggggaagcgcgcaagcaagcccgccggggcggccccaaaggaggcaaaaaggatcgaatgatagaatttcctgtttacccggctcgggttcatccttacatacgattctgtcgcctatatatatggattccttcgccaaggagacgcttccggtatcgctggaagaagagATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG0188 Type IIA topoisomerase (DNA gyrase/topo II, topoisomerase IV), A subunit ... can be seen here
[HE] COG1932 Phosphoserine aminotransferase ... can be seen here
[E] COG0077 Prephenate dehydratase ... can be seen here
[E] COG1605 Chorismate mutase ... can be seen here
[E] COG0287 Prephenate dehydrogenase ... can be seen here
[E] COG0128 5-enolpyruvylshikimate-3-phosphate synthase ... can be seen here
[F] COG0283 Cytidylate kinase ... can be seen here

    ..................................................................................................................