                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=33 nt.     Delta G=-17.90 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-16.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCAGCGCCGGCGCGGGCCGGGCCCAGTGCTACCAGGTGCGCGACAGCGCCTCCCAGC
CCTGGCTGCTGTGGTACGGGGACATCACCGGTTTCGCCTTCCAGCCCGGCATCGAATA
CCGGCTGCGCGTGGTGGAAGTGCGCGACCCCAATCCGCCGGCCGACGCGTCGGGGGTG
CGCTGGGTGCTCGACAGCGTGGTCGAGCAGCGCGTGGCGGCGCCGCGTCCAGCCCCCG
CGCCGTAGcgccttggcggggctgtttactattacgccctgtttttccttcgttcgtgcttttccgccATG

    BP0179 Gene: BP0179     GI: 33591425     BI number: BP0179     GOG: COG1054     Description: conserved hypothetical protei            cg CG       G  c G  T      A  c C  C      T  t C  C       Gt G  A       Cg CG        Cg        ct GC        Gc       a  a GC       C  |      t  t C  |      G  |      t  t GC       C  |       ta GC        Cg        gc T  |       Cg       t  | GC        Cg        cg CG        Cg        gc GC        Gc        gc CG        At        gc GC        Cg        gt                         gtttttccttcgttcgtgcttttccgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1054 Predicted sulfurtransferase ... can be seen here     ..................................................................................................................