Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:119 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=18 nt.     Delta G=-10.60 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-13.13 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCCAGCGCGGCGCCGGCCAGCGCGCGCACGGAATCGGCCACGCCGCCGGCCGGATA
GCCCAGCTCTATCGTGAGGGCGGCCGGGTCCGCGGCCAGATGGATGTCACGATCTTTT
ACACAAACATTCAGCTCCAGGCCGGTCTGCGGATCGGCAACGCCCGCCAACGCGCCGC
GGATTTGTTCTATCGTTATACTCATCACactatggttcccagggtcatcgcgccattacgcgagccgttactcgaagga
tagcggatacgcgggaacctttagcctggttttacatccatatctacATG

    BP0181


Gene: BP0181     GI: 33591427     BI number: BP0181     GOG: -------     Description: putative exported protei


  T
T  T
C  T
T  A
A  C
G  A
C  C
A  A                  G
C  A                C  C
 TA                 A  C
 GC                 A  C
 TA                  CG
 AT                  GC
 GT                  GC
 GC                 |  A
 TA                 |  A
A  G                |  C
 GC                 C  G
 AT        GC       T  C
|  C      T  G      A  G
|  C       CG        GC
|  A       TA        GC
 CG        GT        CG
 CG        GC        GC
 GC        CG        TG
 GC        CG        CG
 CG        GC        TA
                        TTTGTTCTATCGTTATACTCATCACactatggttcccagggtcatcgcgccattacgcgagccgttactcgaaggatagcggatacgcgggaacctttagcctggttttacatccatatctacATG


    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:185 nt.     Distance to run of Ts=1 nt.   Size=39 nt.     Delta G=-11.52 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-18.60 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-29.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCCAGCGCGGCGCCGGCCAGCGCGCGCACGGAATCGGCCACGCCGCCGGCCGGATA
GCCCAGCTCTATCGTGAGGGCGGCCGGGTCCGCGGCCAGATGGATGTCACGATCTTTT
ACACAAACATTCAGCTCCAGGCCGGTCTGCGGATCGGCAACGCCCGCCAACGCGCCGC
GGATTTGTTCTATCGTTATACTCATCACactatggttcccagggtcatcgcgccattacgcgagccgttactcgaagga
tagcggatacgcgggaacctttagcctggttttacatccatatctacATG

    BP0181


Gene: BP0181     GI: 33591427     BI number: BP0181     GOG: -------     Description: putative exported protei


 TC
A  G
A  G
 GC         A
 GC       C  G
C  A      C  C
A  |      C  T       TC
C  |       GC       G  C
 GC        AT       G  G
 CG        TA        GC
 GC        AT        CG
C  |       GC        CG
 GC       G  G       GC
 CG       C  T       GC
 GC       C  G      |  A
A  C      G  A      |  G
 CG       G  G      |  A
 CG        CG       |  T
 GC        CG       |  G
 GC        GC       C  G
 CG        CG       G  A
 CG        CG       G  T
|  A       GC       G  G
|  T      C  C       AT
G  A      A  G       GC
 CG        CG        TA
 GC        CG        GC
 GC        GT        CG
                        ATCTTTTACACAAACATTCAGCTCCAGGCCGGTCTGCGGATCGGCAACGCCCGCCAACGCGCCGCGGATTTGTTCTATCGTTATACTCATCACactatggttcccagggtcatcgcgccattacgcgagccgttactcgaaggatagcggatacgcgggaacctttagcctggttttacatccatatctacATG


    ..................................................................................................................