                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:11 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-14.70 kcal/mol
Antiterminator: Size=59 nt.     Delta G=-26.60 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-12.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGTTTCGATCGTGTCGTACACCCGCTTGCCCTCGCAAGCCTGGATGACTTCGCCCAG
GCACCGGCCCAACAGCCGGATATCGTGACGTAGGGGTTCTGCTGAGTCGGACTGCTGG
CGGATTGCGTTCATCTGAAAGGGATCCGTCGGGGCGCCGTGGCGCTGGGGAATGGGAA
GGATGTGGGTAAGGCGGAACTGGCAATTCGAGACCGGGGCATTGTACGCAGCCATcctt
acaagcgcgggctgcggtacagtcaggccgtggcggccgcgccgcgctttatttgttccggtgtcttATG

    BP0214 Gene: BP0214     GI: 33591458     BI number: BP0214     GOG: COG0603     Description: Conserved hypothetical protei GA        ac A  C      t  a GC        ta CG        cg TG       |  c |  G      c  g |  G      T  c |  C      A  g TA        Cg AT        Cg AT        Gc CG        At GT        Cg         g G  A       Gc       t  g T  C      |  g       gc C  G       Cg        cg A  C       At        cg A  A       Ta        gc G  |       Gc        gc G  |       Ta       a  | CG        Tg       c  | GC        At        tg GC       |  c       gc A  A      |  a      a  | A  T      |  g      c  | T  c       Cg       a  | Gc        Gc        tg Gt        Gc        gc Gt       G  g       gc Ta        Gt        cg Gc        Cg        gc Ta        Cg        tg                         ctttatttgttccggtgtcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0603 Predicted PP-loop superfamily ATPase ... can be seen here     ..................................................................................................................