                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:127 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=50 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G=-10.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCGCGAGATCGCCGCCATCCAGCGGATCAGGCAGAAGTCCTGATCGATCGCCAGGGG
GTAGGGGGAAGCGCCCGCAAGCTCCGCCGGCTCGATCGGCATGACAGGTGCCGGCATC
TCGATACTGCTCATagctgtctcctcgacacacgcggcgcggccgcgcgatggtgttttccctgagagagccggcaagctcctcccagaa
tgatgttatgacggtattataggcatattgtatgattgaatgcttggaattttaacagcgcaccgcgccgcaacaccaacctaggaggagcaacATG

    BP0234 Gene: BP0234     GI: 33591476     BI number: BP0234     GOG: COG1638     Description: putative solute-binding periplasmic protei             A           C  T           T  a            Cg            Gc           T  t            Cg            At           |  c           |  t           |  c           T  c        c   C        At       g  g A  A       Gc        cg G  G       Cg        gc TG        Ta        gc AT       |  c       cg CG       |  a       gc GC       |  c       cg GC       |  a      a  | CG       |  c      c  | TG       C  g      a  | |  C      T  c      c  | |  A      A  g      a  | |  T       Cg        gc |  C       Gc        cg AT       |  g       ta GC        Gc       |  t CG        Cg        cg TA        Cg        cg                         tgttttccctgagagagccggcaagctcctcccagaatgatgttatgacggtattataggcatattgtatgattgaatgcttggaattttaacagcgcaccgcgccgcaacaccaacctaggaggagcaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1638 TRAP-type C4-dicarboxylate transport system, periplasmic component ... can be seen here     ..................................................................................................................