Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:152 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-13.60 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATGGCAAAAACCTGCCATTCGATTCGAGAACTTAGGGATCGGGTGGCTGAGCACTAC
GGACACAACACCGTACAACTGACGTTGACCCTTCCGAGAAGTCAGAGGTGAagaagccgacc
ttccagccgcctccgggcggcttttttgttggccaatgccagcggcctggtggcttacaatcggcaaactattggctgctaggtgtgaagattcaatagg
ttgtatgcatggttcatccgaaccggatttgagaaactggaaatcgccacccccccagttcactcaaggagcccggccggATG

    BP0295 --- BP0294


Gene: BP0295     GI: 33591529     BI number: BP0295     GOG: -------     Description: transposase
Gene: BP0294     GI: 33591528     BI number: BP0294     GOG: NOG41244     Description: putative 5'(3')-deoxyribonucleotidas


  C
C  T
C  T
A  C
 GC
 TG
 TA
|  G
|  A
G  A
 CG
 AT
 GC
 TA
 CG
A  A
A  |        g
C  |      c  a
A  |      c  c
T  |       gc
G  |       at
 CG        at
 CG        gc
 AT       |  c
 CG       |  a       cc
A  A      a  g      t  g
A  a      A  c       cg
C  g       Gc        cg
A  a       Tg        gc
C  a       Gc        cg
A  g       Gc        cg
 Gc        At        gc
 Gc        Gc        at
                        tttttgttggccaatgccagcggcctggtggcttacaatcggcaaactattggctgctaggtgtgaagattcaataggttgtatgcatggttcatccgaaccggatttgagaaactggaaatcgccacccccccagttcactcaaggagcccggccggATG


    ..................................................................................................................