                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:169 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G=-23.40 kcal/mol
Antiterminator: Size=24 nt.     Delta G= -9.50 kcal/mol
Anti-antiterminator:   Size=19 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCCGTCATCGACGCCACCCTGGAGGCGGCCGAACAGGTGTTCGCCACGCTGCGCGCC
TGAtcccgccgcgacgggcagggcccggcccatcggattgttacgatccgatgggcttcacttttttgttttggatcaaaaaaatcagtgacatagcg
cgaaatccagggaaaccccggctcgattgatttcacgatctatggcttaatataactcgatatttccacatattacccacctatgacatcgccgaccggc
cctgccccgacgcgcggcagcgggccggacccgcaggaacagacATG

    BP0314 Gene: BP0314     GI: 33591545     BI number: BP0314     GOG: COG1315     Description: conserved hypothetical protei                       t                     t  a                      gc                      tg            gc        ta           g  c       at ga       g  c       gc c  c      a  g       gc g  g       cg        cg cg        gc        ta cg        gc        at gc        gc        cg |  a      c  a       cg cg        at        cg cg        gc        gc cg        cg        gt                         tcacttttttgttttggatcaaaaaaatcagtgacatagcgcgaaatccagggaaaccccggctcgattgatttcacgatctatggcttaatataactcgatatttccacatattacccacctatgacatcgccgaccggccctgccccgacgcgcggcagcgggccggacccgcaggaacagacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1315 Predicted polymerase, most proteins contain PALM domain, HD hydrolase domain and Zn-ribbon domain ... can be seen here     ..................................................................................................................