                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-15.20 kcal/mol
Antiterminator: Size=15 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-18.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCGGTGGGCCAGATGGGCGCCGTATGGACCGGCGGCGGCACGCTGATCGCCTGGTCC
TCACTGATCGCGGTGGCCGGCTTTGCCCGCGTGCACGTGCTGGACATGGTGCGCGCCC
TGATGCTGCCGGTATTGCTGGCCCTGAGCGTGTCCACGATTGCCGCCATCCTGATCTG
GTCCTGAagcggcgtcgcgcccggggtgcgggttttcccgggcttttatttagtgcttacagtatacaatatataaacattctcgccagcgcgct
tcgcgccagcgctatctacaaggagcagaccATG

    BP0359 Gene: BP0359     GI: 33591588     BI number: BP0359     GOG: COG5424     Description: conserved hypothetical protei AT G  C T  T CG CG |  T |  C T  C AT CG |  A |  a Cg Gc Cg Cg Gc Tg T  t A  | G  | C  | A  |                  g C  |                g  g C  |                c  t T  |                g  t Gc                 t  t Tg         g        gt Gc       c  g       gc Cg        cg        gc Gc        cg        gc A  c       gt        cg Gc        cg        cg Tg        gc        cg Cg        cg        gc                         ttttatttagtgcttacagtatacaatatataaacattctcgccagcgcgcttcgcgccagcgctatctacaaggagcagaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG5424 Pyrroloquinoline quinone (Coenzyme PQQ) biosynthesis protein C ... can be seen here     ..................................................................................................................