Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:200 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-11.00 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-14.60 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G=-10.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cgcctcgggatcggtcttggcatagaccaccagcgtatcggcgtcggggccgttggtgatccacatcttggtgccgttgagcacatagcggtcgcctttc
ttgtcggcgcgcaggcgcatgctgaccacatcggaccccgcgcccggctcgctcatggccagcgcgcccacgtgttcgccgctgaccagcttgggcaggt
agctgtgaagattcaataggttgtatgcatggttcatccgaaccggatttgagaaactggaaatcgccacccccccagttcactcaaggagcccggccgg
ATG

    BP0443


Gene: BP0443     GI: 33591660     BI number: BP0443     GOG: -------     Description: transposas


            c
          t  c
          a  a
           gc
           ta
           gt
           gc
          t  t
 cg       t  |
g  t       gt        ca
 gc        cg       g  c
 cg        cg       a  a
 tg        gt        gt
|  g      g  g       ta
a  g       gc        tg
t  c       gc        gc
 gc        cg        cg
 cg       |  t       cg
 gt       |  t      |  t
 at       t  g       gc
 cg       g  a       tg
 cg        cg        gc
 at        gc        gc
                        tttcttgtcggcgcgcaggcgcatgctgaccacatcggaccccgcgcccggctcgctcatggccagcgcgcccacgtgttcgccgctgaccagcttgggcaggtagctgtgaagattcaataggttgtatgcatggttcatccgaaccggatttgagaaactggaaatcgccacccccccagttcactcaaggagcccggccggATG


    ..................................................................................................................