Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:145 nt.     Distance to run of Ts=3 nt.   Size=32 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGAAGAACTGTTGCGCGTTGGCCGAGGTAGCGGCGCCGGCGACAGCCAAGGCGAGGG
TCAGGGTTTTGATCCAGCTTTTCATAGACATgagggcttctccagtgaaaaagggcgagccttgcggtacaaccctt
tataggttcgggattttgtcatgcacaaaagcgttagccaatgtccggaggggtatcgtttacctgggggtaaacccggcctcgggttatggctacccct
gcccaggttatgacttgccgtgcgcggcgcagccgtcgaaacgaatacgaacaaggaaactcgctGTG

    BP0453


Gene: BP0453     GI: 33591667     BI number: BP0453     GOG: COG3616     Description: low-specificity D-threonine aldolas


  a
g  a
t  a
g  a        c
a  a      a  a
 cg       t  a
 cg        gc
 tg        gc
c  c      |  c
 tg       |  t
 ta       |  t
 cg       c  t
 gc       g  a
 gc       t  t
 gt        ta
 at        cg
g  g       cg
T  c       gt
A  g       at
 Cg        gc
 At        cg
            ggattttgtcatgcacaaaagcgttagccaatgtccggaggggtatcgtttacctgggggtaaacccggcctcgggttatggctacccctgcccaggttatgacttgccgtgcgcggcgcagccgtcgaaacgaatacgaacaaggaaactcgctGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG3616 Predicted amino acid aldolase or racemase ... can be seen here

    ..................................................................................................................