                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-12.40 kcal/mol
Antiterminator: Size=24 nt.     Delta G= -3.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGGTGTCCCGTACGGCTTCGTGTTCGCTGGAAAAGGCAAAGCTCAAGCTCACggatctgc
tcctttgggatgcaccgcggcgcatggggctcgccaggcgaaccgggccaggccggacggtgcgtgtcgttattctttatagagaatttagttctcagta
aaaaatatcttagcggtggctggcacgggcgtcaacgggggcgttgccaagtttttttcttgacaaggcttttccccactcctagactttattcgcaatc
cagataaatattctctataaagaataactaggaggcaacATG

    BP0633 Gene: BP0633     GI: 33591827     BI number: BP0633     GOG: COG3181     Description: putative exported protei            cg           a  g           a  g            cg            tg            gc            cg cg        gt a  g      g  | cg       g  | gc       c  | g  |       at t  |       cg cg        gc gt        gc gc       |  a ta        ta g  a       cg gc        gt cg        gt             tttttcttgacaaggcttttccccactcctagactttattcgcaatccagataaatattctctataaagaataactaggaggcaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................