                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:185 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-18.50 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCGCGTGCTCGAACTGTTCGACATCGAAGTGCCCGGCCCGCACTGGGCCGGCATGT
AGcgcatccgccttcgcctgcctgtacctgaagcctgccccgatggggcaggcttctttgcgtacggccgcaggcagccgcggcagggaatcccccgat
attgacaccggacaattattcagtactatgcgcaattaactcagtgtactaagtagaagcatagaagcaccaaggctgtttgttgttccggtcaagatcc
agccgcccgcattctgcgggcggtggccacaaggggaatacagATG

    BP0682 --- BP0683 Gene: BP0682     GI: 33591875     BI number: BP0682     GOG: COG3181     Description: putative exported protein Gene: BP0683     GI: 33591876     BI number: BP0683     GOG: NOG43948     Description: 4,5-dihydroxyphthalate decarboxylas            ct           c  g            gt            ta           c  c           c  c            gt            cg            ta            ta            cg gc       |  c c  c      |  c        a c  t      |  t      g  t t  t       cg        cg a  c       gc        cg cg       |  c       cg gc       |  c       cg c  |      c  c       gc Gc        cg        ta At        ta        cg Tg        at        cg Gc        cg        gc                         ttctttgcgtacggccgcaggcagccgcggcagggaatcccccgatattgacaccggacaattattcagtactatgcgcaattaactcagtgtactaagtagaagcatagaagcaccaaggctgtttgttgttccggtcaagatccagccgcccgcattctgcgggcggtggccacaaggggaatacagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................