                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:12 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G=-16.40 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-11.20 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-24.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGAGCTCGAAGCCTACCCCAGCGGCCCGGCTGCCTGGCGCCCCGGCCTGATGGAGC
CGGGCGGCGAACGTGCTGCCGCGCCGTGGCCGTTTCGCGCCGTCGCCCACGCCCGCTA
CCAGGCGCTCAGCGCCCGCGACAAGCTGCTGCTCGAACAGCTCGTGCGCACCTTCATC
GACGCCTGCCATGCCGACTACGGCCGCGCGCCGCCGTGGCCGCGCGAGCGCTGAacgcgg
cccgcgatatggaataatgcccctgccgcgccccaccgggcgcgcgcctttatttcagcgagatacATG

    BP0740 Gene: BP0740     GI: 33591918     BI number: BP0740     GOG: COG1743     Description: putative DNA methylas CG G  A CG GC         g C  |      g  a CG        ta GC        at GT        ta TG       a  a |  A       gt G  a       cg        ac C  c       gc       c  c Cg       |  c       cg Gc       |  c       cg Cg       c  c       cg Cg       c  t       gc Gc        cg        cg C  c       gc        gc Gc        gc        cg Cg        cg       |  c Gc        gc        cg Cg        cg        gc                         ctttatttcagcgagatacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1743 Adenine-specific DNA methylase containing a Zn-ribbon ... can be seen here     ..................................................................................................................