                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=1 nt.   Size=20 nt.     Delta G= -6.40 kcal/mol
Antiterminator: Size=15 nt.     Delta G= -4.00 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-23.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCCGGTCTCCAGCCAGTCCAGGTTCACCTGCAGGGCGGCCGCCAGCTTGCGAACCGA
ACGGCTGGATTGCCGTTGGCCGTTCTCGTAGCTGGCTACCGCGCTTTGCGACAGGCCG
CTGGCGCGCGCCAGATCCTGTTGCGTTAGCGAACGCAGTGCCCGCGCATGTTTCAATC
GGTCTGAGAATGTCTTCACggcctgattgaatcgtgcgaatcaagcactatggtggttgaatttattacgttagtgttgaaatgtc
cacctattccattcctgacgattcctgcgccggccgcataTTG

    BP0745 Gene: BP0745     GI: 33591921     BI number: BP0745     GOG: -------     Description: putative transcriptional regulato TG A  T A  C GT AT GC TA |  C Cg Tg Gc Gc |  t Cg Ta At At Cg                  at Ta                 t  g Ta         t        cg T  t      a  c       at Gc       a  a       cg Tg       g  a      g  g At        cg        at Cg        gc        at Gc        ta        cg Cg        gc        ta                         atttattacgttagtgttgaaatgtccacctattccattcctgacgattcctgcgccggccgcataTTG     ..................................................................................................................