                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:163 nt.     Distance to run of Ts=2 nt.   Size=22 nt.     Delta G= -6.90 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-18.70 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-24.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAGGCCTCGCGCACCGGCGTCTGGCTCACGCCCAGGCGTTCGGTCAGCATGCGCAGC
GTGAGGATCTCGCCGGGCTTGAGCTCGCCCATCATCAGCAGCTGCTTGAGCTGGCGAT
AGATGACGGCGGCAATGTTTTCGCGCGCCATGGGCGCGAGCGGCATGTTCATGGAAGG
TGGAATCGGCGCAAAAAGGGGGCGGTTGGCCAATGTTGCCATattcctcggcaacccgctatactttat
aaaatataaattactaaatagccgcgacggcgcggccatcattcaggacgaggcctcATG

    BP0773 --- BP0772 Gene: BP0773     GI: 33591946     BI number: BP0773     GOG: COG0028     Description: putative acetolactate synthase large subunit Gene: BP0772     GI: 33591945     BI number: BP0772     GOG: COG1028     Description: putative acetoacetyl-CoA reductas   C G  A       AT CG       C  C GC       T  A TG       A  G AT       C  C CG       C  A G  A       CG A  G       GC CG       C  T TA       T  | GT        CG GC        GC C  T       AT T  |      G  T       GA T  |      T  G      A  T GC        TA       T  G CG        CG       A  A GC       G  |       GC GC        GC        CG A  |       GT       G  G CG        CG        GC CG        CG        TG CG        GC        CG GC        CG        GC                         AATGTTTTCGCGCGCCATGGGCGCGAGCGGCATGTTCATGGAAGGTGGAATCGGCGCAAAAAGGGGGCGGTTGGCCAATGTTGCCATattcctcggcaacccgctatactttataaaatataaattactaaatagccgcgacggcgcggccatcattcaggacgaggcctcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EH] COG0028 Thiamine pyrophosphate-requiring enzymes [acetolactate synthase, pyruvate dehydrogenase (cytochrome), glyoxylate carboligase, phosphonopyruvate decarboxylase] ... can be seen here [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here     ..................................................................................................................