                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-13.40 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G=-12.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACTACCGCATCGCCAACATCAACGATGTGCTGAAGGTTGGCCAGCCGGTCCGCGTCA
AGGTCATCGAGGCCGACGACAAGGGCCGCCTGCGCCTGTCGATCAAGGCGATCGGCGG
CATCGAGCAGCAGCAGTCCGGTACGGCCGAGCCGGCCGCCCAGTCGGAGCCGCAAGCC
GAATAAggtttgcgattcctgacgcaagaacggcgcccgcgggcgccgtttttgcgtccgcatacggtaaagtcatgccacgcgcggccaggccgc
ctcaggacaagggacacggacggatatggcATG

    BP0796 Gene: BP0796     GI: 33591967     BI number: BP0796     GOG: NOG45972     Description: putative lipoprotei            cc           t  t           t  g           a  a            gc            cg            gc            ta            ta            tg           g  a           g  a           A  |           A  |           T  |           A  |           A  | AT        Gc A  A       Cg G  A       Cg        gc Cg        Gc       c  g Cg       |  g       cg Gt       |  c       cg At       A  c       gc At       A  c       cg Cg        Cg        gc Gc        Gc        gc Cg        Cg        cg                         tttttgcgtccgcatacggtaaagtcatgccacgcgcggccaggccgcctcaggacaagggacacggacggatatggcATG     ..................................................................................................................