                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-18.70 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-30.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCGCGCCGCTGGGCCGCATCGTGGATTTGCATGGCGCCGAGGTGGAGGCCGTCAGC
CTGGATACCGATTGCATCGTCATCGGCATGCGACGCGATCCGGTGGTGCACACCGGCG
ACCGCGTGGCGTTCGTGGCAACGCAATGGGACCAGGCCGATATCGGCGCCGGCTGAgg
cgcggcgccgcgatacccgtccattccgattcgagcaggtccggcgccgcgggcggcgccggtggttgcgttcggcccgcgcccgcggcgcgtggccttt
ttcaacgaagaacagaggggaataccATG

    BP0817 --- BP0818 Gene: BP0817     GI: 33591985     BI number: BP0817     GOG: COG3181     Description: putative exported protein Gene: BP0818     GI: 33591986     BI number: BP0818     GOG: COG0607     Description: conserved hypothetical protei gg c  g gc cg cg gc cg gc gc cg cg |  t t  g g  g gt                   g at        cg       c  c cg       c  c       cg gc        cg        cg a  g       gc        gc g  t       gc        cg c  |      c  |       gc t  |      t  |       cg t  |      t  |      |  t at        gc        cg gc        cg        cg cg        gc        gc cg        tg        gc                         tttttcaacgaagaacagaggggaataccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3181 Uncharacterized protein conserved in bacteria ... can be seen here [P] COG0607 Rhodanese-related sulfurtransferase ... can be seen here     ..................................................................................................................