                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:115 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G=-14.90 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-20.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGCCTGTCCGTCAACGACGACGACTACGACATGCCGCGCATCGAGGCCGAGGTGTTG
CCGCGCCTGCGTGCGCAGCGCGATCACATCCGGCGCCTGATGAGCCTGGGCGAGATGT
AGgcctgcgccactattcccctggttgcagcatgggttgcgcggcatggcgcgggccggccgcattgtttgatggcgcgcaaacgggcgagccgcgctc
ctttccctttgcgcgcgcgggggcgtaaagtagggattgcccgatgcgcggtcgcgcgtcgcacaatgtgttgatggaggacgttATG

    BP0824 Gene: BP0824     GI: 33591992     BI number: BP0824     GOG: COG3241     Description: azuri   g g  g t  t at cg gc a  | cg gc tg tg gc g  a t  | c  | c  | c  | c  | t  | t  |       cg a  |      g  g t  |       cg c  |       gc at        gc cg        tg cg       a  | gc        cg cg        gc gc        gc tg        cg cg        gc             attgtttgatggcgcgcaaacgggcgagccgcgctcctttccctttgcgcgcgcgggggcgtaaagtagggattgcccgatgcgcggtcgcgcgtcgcacaatgtgttgatggaggacgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG3241 Azurin ... can be seen here     ..................................................................................................................