                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-16.90 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -8.40 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-25.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCGCTGGGTACCGTCGTACTGGCGCTTCGACGCCATGGCCGCGTACGAGTTCAACGA
CCACCTGACCGCGCAGCTCAACGTGATGAACATCTTCGACAAGACGTACTACACCAAG
GCCTACGCGGCGCACTACGCGGCGCTGGGCACGGGCCGCGCCGCGGTGCTGTCGTTCA
ATATCAAGTATTGAgcgcagccgcgcagcagggaaaaccggcgcattgcgccggtttttttttggcatggcgcggaaatgctctacgatt
tcaggtgtttgccatcgagccacccgggcggaagacATG

    BP0858 Gene: BP0858     GI: 33592024     BI number: BP0858     GOG: COG1670     Description: probable GnaT-family acetyltransferas   A C  A TG AT TA AT AT CG TA Tg Gc Cg         a T  |      a  a Gc       g  a Ta        gc Cg        gc Gc       a  g        t T  c      c  |      a  t G  g      g  |       cg Gc       a  |       gc Cg        cg        cg Gc        gc        gc C  a       cg        gc Cg        gc        cg Gc       c  a       cg C  a      c  |       at G  |       gt        at Cg        at        at Cg        cg        at                         tttttggcatggcgcggaaatgctctacgatttcaggtgtttgccatcgagccacccgggcggaagacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1670 Acetyltransferases, including N-acetylases of ribosomal proteins ... can be seen here     ..................................................................................................................