                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:195 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G=-13.80 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-20.00 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -8.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTCGTGAGCATCGGGCATaaggaatgtcggggcaaggcaggactgccggcacgcagccgggaagctggcggggcgccgggcagcg
ccgaaaattgccaatttgttacgaaatctttattattttaccagatcatgccgcgaatcccggcgccgggcctggccgggatcggccatcggcagccgtc
ccgacggatgagcggcgccgttgcgcgcgtgcccgcgttgcaggggggtgccgcgccgcgtatgctgggccacccgtctcctgggccaacgtctcttttg
tagggaaacccgctATG

    BP0876 Gene: BP0876     GI: 33592042     BI number: BP0876     GOG: NOG10724     Description: putative lipoprotei            aa        gg           g  g      g  c            gc       c  a            gt        cg            cg        gc            cg        cg            gc        gc   g       |  g       gc c  c      |  g      |  g a  a      a  g      |  a cg        cg       |  a gc        gc       |  a gc       c  |      |  a cg       a  |       gt cg        cg        gt |  g       gc        cg g  a       gc        gc ta        cg        gc cg        cg        ta                         atttgttacgaaatctttattattttaccagatcatgccgcgaatcccggcgccgggcctggccgggatcggccatcggcagccgtcccgacggatgagcggcgccgttgcgcgcgtgcccgcgttgcaggggggtgccgcgccgcgtatgctgggccacccgtctcctgggccaacgtctcttttgtagggaaacccgctATG     ..................................................................................................................