                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:133 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G=-12.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -8.97 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-13.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gggccagtatagcaacgccaagaacaggttcaaaggatcgctactgggtctcctgcgtgctggaaacaatcttaaggcatttgggtggctttggctgccc
tagaccgttgcattgaccgtggatattgagcatttcagggctcgccgccttgatcatgttggtttttggcaacaaggcggggaagcgcgcaagcaagccc
gccggggcggccccaaaggaggcaaaaaggatcgaatgatagaatttcctgtttacccggctcgggttcatccttacatacgattctgtcgcctatatat
ATG

    gyrA --- serC --- pheA Gene: gyrA     GI: 33592101     BI number: BP0944     GOG: COG0188     Description: DNA gyrase subunit A Gene: serC     GI: 33592102     BI number: BP0945     GOG: COG1932     Description: phosphoserine aminotransferase Gene: pheA     GI: 33592103     BI number: BP0946     GOG: COG0077,COG1605     Description: p-protein [includes: chorismate mutase and prephenate dehydratase tt t  g       tg cg       g  g gc       c  a g  t      c  t t  g      a  a gc       g  t gc       t  t gc       t  g        g t  t      a  a      c  c t  a       cg       t  c t  g       gc        cg a  a       ta        gc c  |      t  t       gc gc       g  t       gt gc       c  |       at a  g      c  |       cg a  t       at        ta t  t       gc       |  t t  g      a  |      t  c c  c       ta        ta ta        cg        at at        cg        cg at        cg        gt cg        gc        at                         ggtttttggcaacaaggcggggaagcgcgcaagcaagcccgccggggcggccccaaaggaggcaaaaaggatcgaatgatagaatttcctgtttacccggctcgggttcatccttacatacgattctgtcgcctatatatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0188 Type IIA topoisomerase (DNA gyrase/topo II, topoisomerase IV), A subunit ... can be seen here [HE] COG1932 Phosphoserine aminotransferase ... can be seen here [E] COG0077 Prephenate dehydratase ... can be seen here [E] COG1605 Chorismate mutase ... can be seen here     ..................................................................................................................