                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:115 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-21.50 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-12.40 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-20.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAGCTGCGCGAGTGGGTCGATCTGGTTGGCAACGATCAGGGCGACGACTCGTCCAAC
GGGTCGTCCGACCCGCTGCAATCGGTCATGGATATGCATGCCATGCACTGAtgtgccgcgta
cggcgtcccgcgtggttggtgttctaccggcaaagccccttgcttgttcaaggggctttgttttttcgggccggcgccgcgccgcggcgaaaaagacggc
cggcgcatgtgccgccggccgcggcaatggcgccgcttccgcttacaattactcgtcttgaattctttggagcatgcgtcATG

    BP0952 Gene: BP0952     GI: 33592109     BI number: BP0952     GOG: COG5416     Description: putative membrane protei gt c  a gc cg cg gc t  | g  | tg At         t Gc       t  c T  c       gt C  c       ta A  |       gc Cg        gc Gc        tg        tg Tg        tg       t  t At        gc       c  t Cg       g  a       gc Cg       t  a       ta Gt       g  a       ta T  |       cg        cg At        gc        cg Cg       c  c       cg G  |      c  c       cg Tg       c  c       gc At       t  t       at Tg        gt        at At        cg        at Gt        gc        cg Gc        gt        gt                         tttttcgggccggcgccgcgccgcggcgaaaaagacggccggcgcatgtgccgccggccgcggcaatggcgccgcttccgcttacaattactcgtcttgaattctttggagcatgcgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5416 Uncharacterized integral membrane protein ... can be seen here     ..................................................................................................................