                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:190 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-20.80 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-18.60 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TACGGCCTGGTGGGCGACCTGTTCCAGGTCGTGCCCGAACTGACCGGCGCGCTCTGAg
cggcacgccgcacgcagagagaaagccgcgggctgtcgcccgcggttttttttcggccatgcacggcatggggccgtcggcgagggcgctcgcgtggtta
catctgccgcccggaatgaggttgccctgcgtggcgaggccgattatcgtcgcttggcatactctacgaaatccgccggcgcgcaccctgcaaatgcctg
gccgacctgaccgccagcccgcatcaagactacggagacaaaATG

    BP0964 Gene: BP0964     GI: 33592120     BI number: BP0964     GOG: COG1960     Description: probable acyl-CoA dehydrogenas            ac           c  g            gc            gc            cg            gc           |  a           |  c           A  g            Gc        gt   T        Ta       t  c C  G       Cg        cg T  A       Ta        gc Cg        Cg        gc Gc       |  a       gc Cg       |  g       cg G  |      G  a       gc Cg       C  a       cg Gc       G  a       cg |  a       Cg        gt Gc        Gc        at Cg        Gc        at                         tttttcggccatgcacggcatggggccgtcggcgagggcgctcgcgtggttacatctgccgcccggaatgaggttgccctgcgtggcgaggccgattatcgtcgcttggcatactctacgaaatccgccggcgcgcaccctgcaaatgcctggccgacctgaccgccagcccgcatcaagactacggagacaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1960 Acyl-CoA dehydrogenases ... can be seen here     ..................................................................................................................