                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:76 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -6.20 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-14.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gatcgacgaggccacgcaccagacggctgccgcgggcatgctcgaataggcggccgccaggcccccggcaggctgttgtttttaatccaaacccttgctg
ggcgcggttctccgggcgatttccaaaggatgaaatgatttccccggacggcgccgccgtcttggggtaaattcgatgcatggctcgcaagggctgcggg
gcttgccaaaagtactgtgtttttgtacagtgcattcatggcaagcaccgaacattctttttccgccggttttgggtccccggctgccgcccccgccgcc
TTG

    BP0972 Gene: BP0972     GI: 33592125     BI number: BP0972     GOG: COG1533     Description: conserved hypothetical protei ca g  a cg tg cg gc g  | t  | at cg gc tg         c a  |      c  a g  |      g  a cg        ta tg        ta tg        cg a  c      g  t at       g  a at        gc tg        gt gc        cg gc        gt             gtttttgtacagtgcattcatggcaagcaccgaacattctttttccgccggttttgggtccccggctgccgcccccgccgccTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1533 DNA repair photolyase ... can be seen here     ..................................................................................................................