                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=53 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-33.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGGTTCTCAAGAAAGCCAAGTCGGCTTGAtcgagaccggagccgtgtccggcatgcaaacgtcgacgcgtttgtgtc
tggcacggctttccgcaataaaagggcacccgcaagggtgtccttttattgcgaaaagatatctggaagaaagccttttcagagtaaaagggcacccgca
agggtgcctttttgcatggcggggttactcttgcagctgcctagtttctttttcgttgccgcatgtctgactctgctccttctcgtccacgccgcacgcc
agtgcgtccgctcttcgatcccATG

    BP0976 Gene: BP0976     GI: 33592129     BI number: BP0976     GOG: COG0494     Description: conserved hypothetical protei            ag           a  c           a  c            gt            at            at            gt            gc            ta ca        cg g  a       ta cg       |  g cg       |  t cg       |  a at       |  a cg       |  a gt       a  a gc       t  g gc       a  g at       g  g at       a  c       ca at       a  a      g  a at       a  c       cg ta       a  c       cg at        gc        cg at        cg        at cg        gc        cg gc        ta        gc cg        ta        gc                         tttttgcatggcggggttactcttgcagctgcctagtttctttttcgttgccgcatgtctgactctgctccttctcgtccacgccgcacgccagtgcgtccgctcttcgatcccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [LR] COG0494 NTP pyrophosphohydrolases including oxidative damage repair enzymes ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_pertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:174 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-19.40 kcal/mol Antiterminator: Size=44 nt.     Delta G=-10.92 kcal/mol Anti-antiterminator:   Size=52 nt.     Delta G=-30.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTGGTTCTCAAGAAAGCCAAGTCGGCTTGAtcgagaccggagccgtgtccggcatgcaaacgtcgacgcgtttgtgtc tggcacggctttccgcaataaaagggcacccgcaagggtgtccttttattgcgaaaagatatctggaagaaagccttttcagagtaaaagggcacccgca agggtgcctttttgcatggcggggttactcttgcagctgcctagtttctttttcgttgccgcatgtctgactctgctccttctcgtccacgccgcacgcc agtgcgtccgctcttcgatcccATG     BP0976 Gene: BP0976     GI: 33592129     BI number: BP0976     GOG: COG0494     Description: conserved hypothetical protei ga c  c tg gc         t cg       t  c at       t  c at        cg at        gc cg       |  a gt       g  a tg       c  t at       a  a c  |      c  a gc       g  a gt       g  a cg        tg cg        cg        ca t  |       tg       g  a gc        gc        cg ta        ta        cg gc        gc        cg cg       t  c       at cg       t  |       cg gc       t  |       gt at        gc        gc gt        cg        gc gt        gc        at                         tttattgcgaaaagatatctggaagaaagccttttcagagtaaaagggcacccgcaagggtgcctttttgcatggcggggttactcttgcagctgcctagtttctttttcgttgccgcatgtctgactctgctccttctcgtccacgccgcacgccagtgcgtccgctcttcgatcccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [LR] COG0494 NTP pyrophosphohydrolases including oxidative damage repair enzymes ... can be seen here     ..................................................................................................................