Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-15.60 kcal/mol
Antiterminator: Size=14 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-22.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAAGTGGCCGAGGTGTTCGAGGTGCCGCTGTCGTTTCTCATGGACCCGGCCAATCAT
CGGCTGTACCGCGCCGCGCTGCCCGATGGCTATGTGCGCCAATACTATGCGATGCCAT
GGCAGCGCTATTTCATCTGGGGCGCCACCGCGGGCATGCTGCGCAATCTGTATCAGAC
GGTGCGCGAGGCGCTGCCGGGTTGAccccgccagcgggagtaatattcccgatcagtacggcgcgccgtggcgcgccttttt
tcatcccggcgcagggcgcctcgcagtctggacaggatctagccGTG

    BP0977


Gene: BP0977     GI: 33592130     BI number: BP0977     GOG: COG0667     Description: probable oxidoreductas


 ca
c  g
 gc
 cg
 cg
 cg
|  a
 cg
 At
|  a
|  a
|  t
G  a
T  t
T  t
 Gc
 Gc
 Gc
 Cg
|  a
C  t
 Gc
 Ta
 Cg                  gt
 Gt                 c  g
C  a       gc        cg
G  c      c  g       gc
G  g       gc        cg
A  g       gc        gc
 Gc        cg        cg
 Cg        at        gc
 Gc        tg        gc
                        ttttttcatcccggcgcagggcgcctcgcagtctggacaggatctagccGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG0667 Predicted oxidoreductases (related to aryl-alcohol dehydrogenases) ... can be seen here

    ..................................................................................................................