                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:172 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-21.30 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-16.60 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-31.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCGCCTGATGGTCGAGGCCGAGGACGAAGCGCTGGCGCAGGCCAGCGCCCAGAAGCT
GGCCGACAGCCTGGGCGCCTGAgcaaggtccggacctgcccgaaggcccgcctgatggcgggcctttttgttgcgcgggcgacg
caggcatgcaaggccatgactctgtttgtatcaaatagtcaagcggggtcgtatggtcctcggtggggcggcgtaaacttcatagtcacgtaacatatcg
gtcagattactgacatgacgcgcggccacactggcaggacatttaggagtttcgcgcaATG

    BP1074 Gene: BP1074     GI: 33592214     BI number: BP1074     GOG: COG3176     Description: conserved hypothetical protei   C C  G G  A GC TA CG GC A  | A  | GC AT        cg CG       c  g CG        ta CG        gc GC        gc CG       a  | |  C       at GC        cg AT        gc CG       |  c |  A      |  c Cg       A  g       ga Gc       G  a      t  t |  a       Ta        cg G  a       Cg        cg A  g       Cg        gc Cg        Gc        cg Gt       |  c       cg C  |      |  c       cg Gc        Cg        gc Gc        Gc        gc Tg        Gc        at Cg        Gt        at                         tttgttgcgcgggcgacgcaggcatgcaaggccatgactctgtttgtatcaaatagtcaagcggggtcgtatggtcctcggtggggcggcgtaaacttcatagtcacgtaacatatcggtcagattactgacatgacgcgcggccacactggcaggacatttaggagtttcgcgcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3176 Putative hemolysin ... can be seen here     ..................................................................................................................